Threadless

partog aka pari is a girl, has been a member since August 9, 2008, has scored 651 submissions, giving an average score of 1.70, helping 12 designs get printed.
[arrow pointing up] Poster child for Natural Selection.
of 34 votes, 15% like it
My bellybutton is actually a useless-fact-dispenser.
of 31 votes, 10% like it
Thomas Edison hates environmentalists and their halogen bulbs
of 29 votes, 28% like it
I make up my own theories.
of 29 votes, 17% like it
I have my own theories.
of 30 votes, 13% like it
I once dreamed I was a gypsy who played the accordion.
of 29 votes, 10% like it
I should probably gain some momentum if I ever want to move again
of 26 votes, 23% like it
I've got a lysis to kill
of 28 votes, 4% like it
I talk about people within earshot.
of 28 votes, 18% like it
The sun is a hot mess.
of 28 votes, 29% like it
I pretend to speak many languages.
of 26 votes, 12% like it
I'm the synonym for blatantly amazing.
of 25 votes, 20% like it
I'm synonomous for blatantly amazing.
of 25 votes, 8% like it
I bathe regularly.
of 23 votes, 4% like it
O.G.: Original Geek.
of 24 votes, 13% like it
When I grow up, I want to be human.
of 25 votes, 20% like it
I'm pretty good at life.
of 20 votes, 15% like it
I'm pretty good at wearing clothes.
of 22 votes, 55% like it
Jazz hands can fix any bad situation.
of 19 votes, 32% like it
The best kind of particles are the electrically charged ones
of 16 votes, 25% like it
I like to make up shaboogled words.
of 31 votes, 19% like it
Happy Leif Ericson Day!
of 31 votes, 13% like it
I should have my own wax statue.
of 28 votes, 14% like it
I'd like to meet those live and active yogurt cultures one day.
of 32 votes, 19% like it
Let's pretend we are viruses and take over everything.
of 34 votes, 12% like it
i'm the produckt of natureal selecshun.
of 30 votes, 7% like it
Yeah, those are feelings hanging off my sleeves.
of 15 votes, 7% like it
Lightning Bolts: Weapons of Mass Induction.
of 21 votes, 33% like it
Cloning is the greatest form of flattery.
of 21 votes, 24% like it
Being ambiguous is my favorite pastime...or is it?
of 21 votes, 33% like it
Remember my face; It will come in handy later.
of 22 votes, 14% like it
You are insane. I got out yesterday.
of 23 votes, 9% like it
I'm glad dreams don't come true because I'd be naked right now.
of 22 votes, 14% like it
My brain tells me secrets.
of 20 votes, 20% like it
It's a bird, it's a plane, it's a hallucination!
of 22 votes, 27% like it
Welcome to the present.
of 19 votes, 16% like it
I don't need a cause to run in a marathon.
of 24 votes, 21% like it
Made with 99.99% natural ingredients.
of 19 votes, 11% like it
Love is for insensitive haters.
of 15 votes, 20% like it
God doesn't roll dice, he plays poker.
of 18 votes, 11% like it
The piano is my finger ballroom.
of 18 votes, 11% like it
I expect you to bow to me.
of 19 votes, 21% like it
Ambivalence is okay...maybe not..no it's great...but then again..
of 17 votes, 35% like it
My life tastes like the dentist's office!
of 13 votes, 15% like it
I'm the product of natural selection.
of 16 votes, 31% like it
Einstein is the bomb.
of 13 votes, 38% like it
Einstein is my atomboy.
of 14 votes, 43% like it
Ismism: The newest branch of philosophy
of 18 votes, 28% like it
The mullet: Hair's # 1 killer.
of 15 votes, 33% like it
Tell the whales to save themselves.
of 18 votes, 28% like it
The 80's called; They want your bad hair back.
of 16 votes, 19% like it
I put the w in awesome! [small text] ...cause I felt like it.
of 16 votes, 13% like it
Parakeets make cool noises and come in nice colors.
of 14 votes, 21% like it
You can never truly be random unless the grinch stole christmas.
of 18 votes, 22% like it
I'm actually a hologram.
of 15 votes, 53% like it
Bestseller: Chicken Soup for the Soulless
of 14 votes, 21% like it
Actually, I do want a piece of you.
of 16 votes, 38% like it
Existence is for things that [are] matter.
of 13 votes, 23% like it
When life gives you lemons, make concentrated citric acid.
of 15 votes, 27% like it
I'm the product of natural seleciton.
of 16 votes, 44% like it
Check out my handlebar mustache and bicycle-seat beard!
of 16 votes, 25% like it
I practice all my future conversations in the mirror.
of 18 votes, 17% like it
I'm anatomically correct.
of 15 votes, 20% like it
When I grow up I want to be a spaceship.
of 17 votes, 24% like it
Substitutes: Not the real deal.
of 19 votes, 32% like it
Love my malanthropist club buddies!
of 16 votes, 13% like it
I'm here. Cue the dramatic music.
of 19 votes, 37% like it
Don't hate me because I'm really really rediculously good-looking
of 18 votes, 28% like it
Blood-curdling scream: Music to my fears.
of 16 votes, 19% like it
Video killed the radiologist.
of 17 votes, 24% like it
Buzz Lightyear is my hero.
of 16 votes, 31% like it
Established circa guess my age
of 17 votes, 12% like it
My soul is gentle. [small] Wash in cold water + dry on low heat.
of 17 votes, 18% like it
I'm only homosapien!
of 12 votes, 50% like it
You lack sanity. Caww...Caww...Caww;just practicing my bird calls
of 15 votes, 13% like it
I live life like it's my job.
of 15 votes, 20% like it
Violins taste like tangeringes and toothpaste sprinkled with blue
of 15 votes, 33% like it
Let's play the facial hair game!
of 20 votes, 15% like it
You say world peace. I say how peaceful!?
of 18 votes, 28% like it
I play calculator games when I am bored.
of 19 votes, 21% like it
Got a ticket...to the pun show?
of 21 votes, 19% like it
You can call me chief.
of 22 votes, 14% like it
I'll take care of this; I have a badge.
of 18 votes, 39% like it
It's OK, I have a badge.
of 20 votes, 25% like it
Sometimes I think I'm from the Elizebethan Era and wear tights.
of 19 votes, 32% like it
Seinfeld was right about everything in life.
of 25 votes, 24% like it
Overachievers: complete assignment on back of shirt for 5 points
of 21 votes, 19% like it
I need to go Bach in time to fix that baroquen music scene.
of 23 votes, 30% like it
Calm down. That's what chi said!
of 20 votes, 10% like it
My alter ego tells me I'm crazy.
of 18 votes, 28% like it
You have no household value.
of 18 votes, 22% like it
I am smarter than I am.
of 21 votes, 24% like it
I can grow a mustache like Salvador Dali's in one hour.
of 18 votes, 17% like it
I have my own theme song. [in small text w/a button] Press here.
of 23 votes, 48% like it
Note to self: write notes on a note-pad, not a t-shirt.
of 17 votes, 29% like it
I'm not touching you...my atoms are repelling yours!
of 22 votes, 14% like it
(-1)^1/2 <3 u
of 29 votes, 24% like it
Teradactyls make the best siblings
of 26 votes, 12% like it
I'm the cat's pajamas.
of 26 votes, 12% like it
Never leave home without an umbrella and all of your DNA.
of 24 votes, 4% like it
My real name is AGTCCGTTCAATATCGATACGATCGATAGCTAGCTAGCTAGCTAGCTAG
of 23 votes, 22% like it
Do you want to borrow some DNA?I carry some with me at all times.
of 21 votes, 10% like it
!nottub dniwer ym dnuof yllanif I
of 24 votes, 17% like it
A penny saved is a piece of soon-to-be junk metal.
of 22 votes, 18% like it
Whatever sinks your boat
of 23 votes, 30% like it
I only look like this because I got struck by lightning thrice.
of 20 votes, 20% like it
You can bet your bottom dollar that it's your last dollar.
of 18 votes, 17% like it
My ambition is so blind, I got it a seeing-eye dog.
of 22 votes, 14% like it
Don't jump to conclusions, do a backflip.
of 22 votes, 14% like it
92% of all statistics are wrong
of 21 votes, 14% like it
Danger is my middle name. No, really, it is.
of 19 votes, 16% like it
Take a light jog on the wild side.
of 18 votes, 11% like it
I listen to underground, subterrainian, indie-raggae rap.
of 21 votes, 24% like it
Wake up and smell the crazy.
of 21 votes, 14% like it
Youth is wasted on the old. That's why they're old.
of 24 votes, 33% like it
While you're in the lap of luxury, I'm stuck to it's pinky toe.
of 21 votes, 24% like it
I'd give you the shirt off my back, but then I'd be naked.
of 17 votes, 29% like it
I'm all ears. I was born this way.
of 18 votes, 17% like it
Like pees in a port-a-Poddy.
of 18 votes, 28% like it
I hate when people don't finish what they
of 17 votes, 29% like it
I'm allergic to that.
of 16 votes, 19% like it
I'm not old as dirt, I'm young as carbon.
of 20 votes, 25% like it
Sunday,Monday,Tuesday, Wednesday,Thursday, Friday,Saturday shirt.
of 17 votes, 24% like it
Time to go play bingo with grandma!
of 22 votes, 14% like it
Let the chips fall where they may, but remember the 5-sec rule!
of 24 votes, 42% like it
Break a leg. Pull a hamstring. Slip a disc. Good luck!
of 20 votes, 30% like it
Business in the front, small gathering in the back.
of 18 votes, 22% like it
Money doesn't grow on trees, but it's made of them.
of 22 votes, 18% like it
Don't have a cow; have a couple of these assorted animals.
of 20 votes, 20% like it
Time's on my side. Yeah, we're attached at the hip.
of 21 votes, 10% like it
Keep destroying the ozone layer--then we can all go to space.
of 23 votes, 17% like it
An eye for an eye makes the demand for opthamologists go up 476%
of 35 votes, 23% like it
Every thing I touch turns to gold.
of 35 votes, 14% like it
Slogans that have been deleted or that have been dropped from the contest
God doesn't roll dice.
of 15 votes, 7% like it
Landslides are the best kind of natural disaster.
of 19 votes, 5% like it
Tattletales: Beware of secrestories.
of 19 votes, 11% like it
To thine self be you.
of 20 votes, 10% like it
WARNING:Do not puncture. Contains Pressurized Gas
of 18 votes, 11% like it
Yeah, those are feeling hanging off my sleeves.
of 14 votes, 14% like it

My gallery photos

I haven't submitted any photos. I guess I don't want free money.

All about me

I spend approxamitely 2 hours a day on threadless...b/c I LOVE IT!!!

Tees I own:
*Carbon
*Some things are just out of reach
*The sea + the sky
*Follow it
*Bubbly beginning
*Nerds Unite!
*Now that's dope

I'd seriously have all of them if I wasn't broke ;)